Top » Catalog » SNPs » YP5190

$18.00

YP5190
[YP5190]

YP5190
hg38 Position: ChrY:21607933..21607933
Ancestral: G
Derived: A
Reference: YFull
ISOGG Haplogroup: R1a1a1a (not listed)
Comments: Below YP1014.
Forward Primer: YP5190_F GAAAAGAGATGACAAGACAATTTCG
Reverse Primer: YP5190_R CCTCTATCCAGAGTCCTGTGC
Reviews

Customers who bought this product also purchased
R1a-L664 Panel
R1a-L664 Panel
YP1015
YP1015
YP1014
YP1014
YP441
YP441
YP282
YP282
BY62687
BY62687
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies