Top » Catalog » SNPs » Z283

$18.00

Z283
[Z283]

Z283
hg38 Position: ChrY:19814417..19814417
Ancestral: T
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b1
Comments: Below Z645, peer to Z93. Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z283_F CCACTGATGATTGTATGGAATTG
Reverse Primer: Z283v2_R AGGCATAGGACTTCAAGTAGGAC
Reviews

Customers who bought this product also purchased
YP4622
YP4622
YP1046
YP1046
L122
L122
PH864
PH864
M438
M438
Y2910
Y2910
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies