Top » Catalog » SNPs » YP5717

$18.00

YP5717
[YP5717]

YP5717
hg38 Position: ChrY:15423098..15423098
Ancestral: C
Derived: T
Reference: YDNA-community (2016)
ISOGG Haplogroup: R1a1a1b2a2a (not listed)
Comments: Below Z2123 > Y20746 > Y2634
Forward Primer: YP5717_F CTGACTTCTAGGTACTAATGGAACAG
Reverse Primer: YP5717_R CAGGCAAAGGAGACAGTAAATC
Reviews

Customers who bought this product also purchased
Y20746
Y20746
Y934
Y934
Y79089
Y79089
Z2123
Z2123
Y2633
Y2633
Z2124
Z2124
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies