Top » Catalog » SNPs » YP5717

$18.00

YP5717
[YP5717]

YP5717
hg38 Position: ChrY:15423098..15423098
Ancestral: C
Derived: T
Reference: YDNA-community (2016)
ISOGG Haplogroup: R1a1a1b2a2a (not listed)
Comments: Below Z2123 > Y20746 > Y2634
Forward Primer: YP5717_F CTGACTTCTAGGTACTAATGGAACAG
Reverse Primer: YP5717_R CAGGCAAAGGAGACAGTAAATC
Reviews

Customers who bought this product also purchased
Z2123
Z2123
Y2633
Y2633
Z2124
Z2124
SUR51
SUR51
R1a-Z93 Panel
R1a-Z93 Panel
Y2632
Y2632
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies