Top » Catalog » SNPs » BY16028

$18.00

BY16028
[BY16028]

BY16028
hg38 Position: ChrY:16053401..16053401
Ancestral: G
Derived: A
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b1a1a2a1a2c1a3a2a1a1 (not listed)
Comments: Below Z16521.
Forward Primer: BY16028_F GAATGTGTACAAGGTGTGAGCAG
Reverse Primer: BY16028_R AGTGTGGAGTTCAAGGAGCTG
Reviews

Customers who bought this product also purchased
BY39364
BY39364
Z16521
Z16521
FGC29280
FGC29280
S1121
S1121
FT43021
FT43021
A1133
A1133
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies