Top » Catalog » SNPs » BY16028

$18.00

BY16028
[BY16028]

BY16028
hg38 Position: ChrY:16053401..16053401
Ancestral: G
Derived: A
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b1a1a2a1a2c1a3a2a1a1 (not listed)
Comments: Below Z16521.
Forward Primer: BY16028_F GAATGTGTACAAGGTGTGAGCAG
Reverse Primer: BY16028_R AGTGTGGAGTTCAAGGAGCTG
Reviews

Customers who bought this product also purchased
BY39364
BY39364
Z16521
Z16521
FGC29280
FGC29280
A159
A159
FGC42469
FGC42469
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies