Top » Catalog » SNPs » FGC54816

$18.00

FGC54816
[FGC54816]

FGC54816
hg38 Position: ChrY:21418697..21418697
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a3 (not listed)
Comments: Below BY9002.
Forward Primer: FGC54816_F CATAAGCACCTTCCAATCCATAAG
Reverse Primer: FGC54816_R AAAGTTTCAGCCTATTCAAATCTG
Reviews

Customers who bought this product also purchased
FGC5494
FGC5494
FGC11293
FGC11293
DF49
DF49
Z255
Z255
A9871
A9871
DF13
DF13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies