Top » Catalog » SNPs » FGC54816

$18.00

FGC54816
[FGC54816]

FGC54816
hg38 Position: ChrY:21418697..21418697
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a3 (not listed)
Comments: Below BY9002.
Forward Primer: FGC54816_F CATAAGCACCTTCCAATCCATAAG
Reverse Primer: FGC54816_R AAAGTTTCAGCCTATTCAAATCTG
Reviews

Customers who bought this product also purchased
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
BY11096
BY11096
Z253
Z253
FGC5494
FGC5494
FGC11293
FGC11293
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies