Top » Catalog » SNPs » FGC54816

$18.00

FGC54816
[FGC54816]

FGC54816
hg38 Position: ChrY:21418697..21418697
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a3 (not listed)
Comments: Below BY9002.
Forward Primer: FGC54816_F CATAAGCACCTTCCAATCCATAAG
Reverse Primer: FGC54816_R AAAGTTTCAGCCTATTCAAATCTG
Reviews

Customers who bought this product also purchased
FGC11134
FGC11134
A353
A353
Z39589
Z39589
L513
L513
S1115
S1115
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC67293
1 x CTS9501
$36.00
Haplogroup Info
Other products
Currencies