Top » Catalog » SNPs » Z2432

$18.00

Z2432
[Z2432]

Z2432
hg38 Position: ChrY:7640041..7640041
Ancestral: G
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: J2b2 (not listed)
Comments: Downstream of J-M241 and parallel to L283
Forward Primer: Z2432_F GAGATGTTGAATGAAAATGTACACAAC
Reverse Primer: Z2432_R GTGTAAATGGAAGCGGATCAA
Reviews (1)

Customers who bought this product also purchased
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
M201
M201
Z42941
Z42941
M438
M438
M410
M410
P38
P38
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies