Top » Catalog » SNPs » Z2432

$18.00

Z2432
[Z2432]

Z2432
hg38 Position: ChrY:7640041..7640041
Ancestral: G
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: J2b2 (not listed)
Comments: Downstream of J-M241 and parallel to L283
Forward Primer: Z2432_F GAGATGTTGAATGAAAATGTACACAAC
Reverse Primer: Z2432_R GTGTAAATGGAAGCGGATCAA
Reviews (1)

Customers who bought this product also purchased
P38
P38
M216
M216
Y130898
Y130898
M173
M173
M172
M172
Y86930
Y86930
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies