Top » Catalog » SNPs » Z2432

$18.00

Z2432
[Z2432]

Z2432
hg38 Position: ChrY:7640041..7640041
Ancestral: G
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: J2b2 (not listed)
Comments: Downstream of J-M241 and parallel to L283
Forward Primer: Z2432_F GAGATGTTGAATGAAAATGTACACAAC
Reverse Primer: Z2432_R GTGTAAATGGAAGCGGATCAA
Reviews (1)

Customers who bought this product also purchased
Z38240
Z38240
CTS6190
CTS6190
BY161113
BY161113
Z2521
Z2521
Z42942
Z42942
BY179434
BY179434
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies