Top » Catalog » SNPs » Y2770

$18.00

Y2770
[Y2770]

Y2770
hg38 Position: ChrY:8400613..8400613
Ancestral: G
Derived: A
Reference: Vladimir Gurianov (2013)
ISOGG Haplogroup: Q1b1 (not listed)
Comments: Private SNPs for Kz1 sample Aka. FGC4873 Aka YFS026361
Forward Primer: Y2770_F AAGGCCTTTTTTCTTCTTAGAAGAG
Reverse Primer: Y2770_R TTTTTTTACCTGACTCTACCAGCC
Reviews

Customers who bought this product also purchased
Y20198
Y20198
MZ110
MZ110
MZ109
MZ109
MZ23
MZ23
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies