Top » Catalog » SNPs » YP5598

$18.00

YP5598
[YP5598]

YP5598
hg38 Position: ChrY:8327804..8327804
Ancestral: G
Derived: T
Reference: YDNA-community (2016)
ISOGG Haplogroup: R1a1a1b1a3a (not listed)
Comments: Below YP4252.
Forward Primer: YP5598_F GCGCAGGATGGTGAGTTG
Reverse Primer: YP5598_R TGCAGGCCTAGGAATAGGTTAC
Reviews

Customers who bought this product also purchased
YP4253
YP4253
R1a-Z284 Panel
R1a-Z284 Panel
YP4248
YP4248
YP5007
YP5007
L448
L448
YP355
YP355
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies