Top » Catalog » SNPs » YP314

$18.00

YP314
[YP314]

YP314
hg38 Position: ChrY:8045733..8045733
Ancestral: G
Derived: A
Reference: R1a community
ISOGG Haplogroup: R1a1a1b1a2b3d
Comments: Below YP325.
Forward Primer: YP314_F TTACCGCCATGGGTAAAGTC
Reverse Primer: YP314_R CAACACCTCCTGTGAATTGG
Reviews

Customers who bought this product also purchased
YP1428
YP1428
Y2902
Y2902
Y5973.2
Y5973.2
S18681
S18681
YP1361
YP1361
BY334
BY334
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies