Top » Catalog » SNPs » YP3929

$18.00

YP3929
[YP3929]

YP3929
hg38 Position: ChrY:15837922..15837922
Ancestral: T
Derived: C
Reference: YDNA-community (2015)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Below Y2608.
Forward Primer: YP3929_F AACCACCCATTATGTGAGTCTG
Reverse Primer: YP3929_R TGGCACAATCATAGCTCACTG
Reviews

Customers who bought this product also purchased
BY27373
BY27373
Y2194
Y2194
Y33
Y33
Y35
Y35
YP5502
YP5502
R1a-M458 Panel
R1a-M458 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies