Top » Catalog » SNPs » YP6098

$18.00

YP6098
[YP6098]

YP6098
hg38 Position: ChrY:21444654..21444654
Ancestral: A
Derived: G
Reference: YDNA-community (2017)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Below Y2608.
Forward Primer: YP6098_F AACATCCACCCATCTATTGAGG
Reverse Primer: YP6098_R GAAATTCAACCTGGTTTCACAAC
Reviews

Customers who bought this product also purchased
Y2194
Y2194
Y33
Y33
Y35
Y35
BY27373
BY27373
YP5502
YP5502
R1a-M458 Panel
R1a-M458 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies