Top » Catalog » SNPs » YP6098

$18.00

YP6098
[YP6098]

YP6098
hg38 Position: ChrY:21444654..21444654
Ancestral: A
Derived: G
Reference: YDNA-community (2017)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Below Y2608.
Forward Primer: YP6098_F AACATCCACCCATCTATTGAGG
Reverse Primer: YP6098_R GAAATTCAACCTGGTTTCACAAC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Y33
Y33
Y35
Y35
BY27373
BY27373
Y2194
Y2194
YP5502
YP5502
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies