Top » Catalog » SNPs » YP6098

$18.00

YP6098
[YP6098]

YP6098
hg38 Position: ChrY:21444654..21444654
Ancestral: A
Derived: G
Reference: YDNA-community (2017)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Below Y2608.
Forward Primer: YP6098_F AACATCCACCCATCTATTGAGG
Reverse Primer: YP6098_R GAAATTCAACCTGGTTTCACAAC
Reviews

Customers who bought this product also purchased
R1a-M458 Panel
R1a-M458 Panel
YP5502
YP5502
Y2613
Y2613
Z91
Z91
M458
M458
R1a Superclade Panel
R1a Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies