Top » Catalog » SNPs » YP6098

$18.00

YP6098
[YP6098]

YP6098
hg38 Position: ChrY:21444654..21444654
Ancestral: A
Derived: G
Reference: YDNA-community (2017)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Below Y2608.
Forward Primer: YP6098_F AACATCCACCCATCTATTGAGG
Reverse Primer: YP6098_R GAAATTCAACCTGGTTTCACAAC
Reviews

Customers who bought this product also purchased
YP1034
YP1034
YP4286
YP4286
R1a-Z280 Panel
R1a-Z280 Panel
YP343
YP343
Y2609
Y2609
YP3929
YP3929
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies