Top » Catalog » SNPs » YP5578

$18.00

YP5578
[YP5578]

YP5578
hg38 Position: ChrY:2993829..2993829
Ancestral: A
Derived: G
Reference: YDNA-community (2016)
ISOGG Haplogroup: R1a (not listed)
Comments: Below Z93
Forward Primer: YP5578_F CCCATGAGTTAAATTCTTCAAAGG
Reverse Primer: YP5578_R CATGAATACATGAATCCCCAAAC
Reviews

Customers who bought this product also purchased
BY9
BY9
Y28816
Y28816
L657
L657
YP1506
YP1506
Z2124
Z2124
YP5585
YP5585
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies