Top » Catalog » SNPs » Y34264

$18.00

Y34264
[Y34264]

Y34264
hg38 Position: ChrY:22260611..22260611
Ancestral: C
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Below YP4659.
Forward Primer: Y34264_F TGGGATTTTTCCTCATTTTCC
Reverse Primer: Y34264_R AGAAATCCCCAAAGGACCAC
Reviews

Customers who bought this product also purchased
Y2395
Y2395
BY99654
BY99654
Z282
Z282
YP581
YP581
Z93
Z93
YP235
YP235
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies