Top » Catalog » SNPs » Y34264

$18.00

Y34264
[Y34264]

Y34264
hg38 Position: ChrY:22260611..22260611
Ancestral: C
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Below YP4659.
Forward Primer: Y34264_F TGGGATTTTTCCTCATTTTCC
Reverse Primer: Y34264_R AGAAATCCCCAAAGGACCAC
Reviews

Customers who bought this product also purchased
M458
M458
YP237
YP237
R1a Superclade Panel
R1a Superclade Panel
Z91
Z91
Y2395
Y2395
BY99654
BY99654
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies