Top » Catalog » SNPs » YP6186

$18.00

YP6186
[YP6186]

YP6186
hg38 Position: ChrY:8660423..8660423
Ancestral: G
Derived: A
Reference: YDNA-community (2017)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Below YP4659.
Forward Primer: YP6186_F TATGCCAGGCTGTGTGTTTC
Reverse Primer: YP6186_R AGCTGGGAACCGAATTACAG
Reviews

Customers who bought this product also purchased
BY99654
BY99654
Z282
Z282
YP581
YP581
Z93
Z93
YP235
YP235
M458
M458
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies