Top » Catalog » SNPs » Y23598

$18.00

Y23598
[Y23598]

Y23598
hg38 Position: ChrY:16279826..16279826
Ancestral: T
Derived: C
Reference: YFull (2016)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Below YP4968.
Forward Primer: Y23598_F TCTGATGCACACACATCATAGAAG
Reverse Primer: Y23598_R CTGTCTCAAAAATGGGAATGG
Reviews

Customers who bought this product also purchased
BY334
BY334
Y3219
Y3219
CTS1211
CTS1211
FGC10360
FGC10360
YP1144
YP1144
R1a-Z280 Panel
R1a-Z280 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies