Top » Catalog » SNPs » Y23598

$18.00

Y23598
[Y23598]

Y23598
hg38 Position: ChrY:16279826..16279826
Ancestral: T
Derived: C
Reference: YFull (2016)
ISOGG Haplogroup: R1a1a1b1a2b3 (not listed)
Comments: Below YP4968.
Forward Primer: Y23598_F TCTGATGCACACACATCATAGAAG
Reverse Primer: Y23598_R CTGTCTCAAAAATGGGAATGG
Reviews

Customers who bought this product also purchased
Y3222
Y3222
S18681
S18681
YP4968
YP4968
YP237
YP237
PH3519
PH3519
BY334
BY334
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies