Top » Catalog » SNPs » Y2174

$18.00

Y2174
[Y2174]

Y2174
hg38 Position: ChrY:14081950..14081950
Ancestral: G
Derived: A
Reference: Semargl (2013)
ISOGG Haplogroup: R2a2b1b2b2b2a1a1
Comments: Found from public sources. Below Y1329. Equiv and possible co-mutation with Y2175.
Forward Primer: Y2174_F TGCAGCCTCACAATGCAC
Reverse Primer: Y2174_R ACAAAGCAAAACCCCATCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies