Top » Catalog » SNPs » Y33761

$18.00

Y33761
[Y33761]

Y33761
hg38 Position: ChrY:7010673..7010673
Ancestral: T
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: I2
Comments: Downstream from L233 > Y4252
Forward Primer: Y33761_F CAAAATGAAGCCAGAACTTGG
Reverse Primer: Y33761_R GATTACAGGCACCCACCATC
Reviews

Customers who bought this product also purchased
A19485
A19485
A19384
A19384
L160
L160
FGC56815
FGC56815
CTS595
CTS595
L233
L233
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies