Top » Catalog » SNPs » FGC58496

$18.00

FGC58496
[FGC58496]

FGC58496
HG19 Position: ChrY:10057526..10057526
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC58496vl_F CAGCAAGGTGACAGTCTGTTG
Reverse Primer: FGC58496vl_R AGAAAGTTATGAACTTTGGGCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies