Top » Catalog » SNPs » Y33783

$18.00

Y33783
[Y33783]

Y33783
hg38 Position: ChrY:16975658..16975658
Ancestral: C
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: I1a
Comments: Below Z73 > Z2900 > Y7654
Forward Primer: Y33783_F AGGAAGATGGCACCAATGAG
Reverse Primer: Y33783_R CTGACCTGACCAAGTGCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies