Top » Catalog » SNPs » FGC12521

$18.00

FGC12521
[FGC12521]

FGC12521
HG19 Position: ChrY:9762593..9762593
Ancestral: T
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: FGC12521_F TCAGCAATAGTCCACAGTATGACC
Reverse Primer: FGC12521_R CCAGCCTGTGGCTAAAAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies