Top » Catalog » SNPs » FGC12858

$18.00

FGC12858
[FGC12858]

FGC12858
HG19 Position: ChrY:8812338..8812338
Ancestral: T
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC12858_F TTTGCTGTGCAGAAGCTCTTTC
Reverse Primer: FGC12858_R AGAGAACTACAAACCTATGCTCAACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies