Top » Catalog » SNPs » FGC16726

$18.00

FGC16726
[FGC16726]

FGC16726
HG19 Position: ChrY:21578152..21578152
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC4230
Forward Primer: FGC16726_F TCAAACCACAGTGATAAAAATCTGTTTC
Reverse Primer: FGC16726_R AGGTAGCCAAAATGATGGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies