Top » Catalog » SNPs » PF3928

$18.00

PF3928
[PF3928]

PF3928
hg38 Position: ChrY:20467824..20467824
Ancestral: G
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: unknown
Comments: Observed in hg I and R1b-CTS9219
Forward Primer: PF3928_F GGACTTCCTGGGTCAGTGAG
Reverse Primer: PF3928_R CTCCCAGTGGGTTCTTTGTC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies