Top » Catalog » SNPs » A18037

$18.00

A18037
[A18037]

A18037
hg38 Position: ChrY:8427922..8427922
Ancestral: G
Derived: T
Reference: Alex Buchanan (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A18037_F GTGATGCAAACAAGCAATGG
Reverse Primer: A18037_R TTCTCCCATTTTGGAGGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies