Top » Catalog » SNPs » A18038

$18.00

A18038
[A18038]

A18038
HG19 Position: ChrY:24513461..24513461
Ancestral: G
Derived: T
Reference: Alex Buchanan (2017)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A18038_F CACCTAGTGGATCCCACACC
Reverse Primer: A18038_R GCAGACCCTGCAGTCAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies