Top » Catalog » SNPs » L723

$18.00

L723
[L723]

L723
hg38 Position: ChrY:19617078..19617078
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R2a2b1b2b1
Comments: Found in a hg R-L295 WTY participant. Below L295.
Forward Primer: L723_F CTCCACAGAGGAGCCTCAAG
Reverse Primer: L723_R TGTCATGGAAGGCAGTTCTTC
Reviews

Customers who bought this product also purchased
Y1281
Y1281
Z29162
Z29162
V3467
V3467
Y1361
Y1361
L295
L295
FGC18152
FGC18152
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies