Top » Catalog » SNPs » L723

$18.00

L723
[L723]

L723
hg38 Position: ChrY:19617078..19617078
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R2a2b1b2b1
Comments: Found in a hg R-L295 WTY participant. Below L295.
Forward Primer: L723_F CTCCACAGAGGAGCCTCAAG
Reverse Primer: L723_R TGTCATGGAAGGCAGTTCTTC
Reviews

Customers who bought this product also purchased
Z29162
Z29162
V3467
V3467
Y1361
Y1361
L295
L295
FGC18152
FGC18152
R2-M479 Panel
R2-M479 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies