Top » Catalog » SNPs » Y1340

$18.00

Y1340
[Y1340]

Y1340
hg38 Position: ChrY:8790047..8790047
Ancestral: G
Derived: A
Reference: Semargl (2013)
ISOGG Haplogroup: R2a2b1b2b3b
Comments: Found from public sources. Below Y1334.
Forward Primer: Y1340_F CTTTTGGAGATCCACTGCAC
Reverse Primer: Y1340_R TGGATGCTTTCTCACCACTG
Reviews

Customers who bought this product also purchased
R2-M479 Panel
R2-M479 Panel
L723
L723
Y1281
Y1281
Z29162
Z29162
V3467
V3467
Y1361
Y1361
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies