Top » Catalog » SNPs » Y1340

$18.00

Y1340
[Y1340]

Y1340
hg38 Position: ChrY:8790047..8790047
Ancestral: G
Derived: A
Reference: Semargl (2013)
ISOGG Haplogroup: R2a2b1b2b3b
Comments: Found from public sources. Below Y1334.
Forward Primer: Y1340_F CTTTTGGAGATCCACTGCAC
Reverse Primer: Y1340_R TGGATGCTTTCTCACCACTG
Reviews

Customers who bought this product also purchased
Z29162
Z29162
V3467
V3467
Y1361
Y1361
L295
L295
FGC18152
FGC18152
R2-M479 Panel
R2-M479 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A13639
1 x A6975
1 x BY4526
1 x A7065
1 x Y6485
1 x A18708
$108.00
Haplogroup Info
Other products
Currencies