Top » Catalog » SNPs » Y1340

$18.00

Y1340
[Y1340]

Y1340
hg38 Position: ChrY:8790047..8790047
Ancestral: G
Derived: A
Reference: Semargl (2013)
ISOGG Haplogroup: R2a2b1b2b3b
Comments: Found from public sources. Below Y1334.
Forward Primer: Y1340_F CTTTTGGAGATCCACTGCAC
Reverse Primer: Y1340_R TGGATGCTTTCTCACCACTG
Reviews

Customers who bought this product also purchased
L723
L723
Y1281
Y1281
Z29162
Z29162
V3467
V3467
Y1361
Y1361
L295
L295
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies