Top » Catalog » SNPs » S26062

$18.00

S26062
[S26062]

S26062
hg38 Position: ChrY:22217162..22217162
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1a2a1a2~
Comments: Below Z62
Forward Primer: S26062_F GGGCTCAAGTGATTCTCTGC
Reverse Primer: S26062_R TGGTTTTATTACAAAGCATTGTCTG
Reviews

Customers who bought this product also purchased
Z63
Z63
FGC23827
FGC23827
Z59
Z59
FGC23806
FGC23806
M253
M253
Z62
Z62
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies