Top » Catalog » SNPs » Y34406

$18.00

Y34406
[Y34406]

Y34406
hg38 Position: ChrY:7319205..7319210
Ancestral: ins
Derived: del
Reference: YFull (2017)
ISOGG Haplogroup: B2b1a1~ (not listed)
Comments: Below Y33420
Forward Primer: Y34406_F AGCACTTTGGCCTCTAGCC
Reverse Primer: Y34406_R TTAAATGCGGGACTCTTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies