Top » Catalog » SNPs » A9538

$18.00

A9538
[A9538]

A9538
hg38 Position: ChrY:17261161..17261161
Ancestral: T
Derived: C
Reference: William Hartley (2016)
ISOGG Haplogroup: I1
Comments: Downstream I-Z140+ Z2535+ A375+ S1972+
Forward Primer: A9538_F GCCCTGGGTATTTCTTCCTC
Reverse Primer: A9538_R TGGAGAGACTGGATGTGGTG
Reviews

Customers who bought this product also purchased
A9541
A9541
A9540
A9540
A9539
A9539
A9542
A9542
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies