Top » Catalog » SNPs » Y10818

$18.00

Y10818
[Y10818]

Y10818
HG19 Position: ChrY:8124137..8124137
Ancestral: T
Derived: C
Reference: Yfull (2015)
ISOGG Haplogroup: R-YP507
Comments: Aka A372
Forward Primer: Y10818_F TTTTGAAAGCCCCTGTTCAC
Reverse Primer: Y10818_R GCCAGGCTTGTCTCAAACTC
Reviews

Customers who bought this product also purchased
M1960
M1960
Y10819
Y10819
YP277
YP277
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies