Top » Catalog » SNPs » YP277

$18.00

YP277
[YP277]

YP277
hg38 Position: ChrY:16026050..16026050
Ancestral: G
Derived: C
Reference: R1a community
ISOGG Haplogroup: R1a1a1b1a3a1a1
Comments: Aka FGC11908
Forward Primer: YP277_F AGCCAAACGATGCCAGTAAG
Reverse Primer: YP277_R GCCCACTGTCTGGAACTCTC
Reviews

Customers who bought this product also purchased
Y10819
Y10819
Y10818
Y10818
M1960
M1960
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies