Top » Catalog » SNPs » Y21903

$18.00

Y21903
[Y21903]

Y21903
hg38 Position: ChrY:19252782..19252782
Ancestral: C
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: B2a1a1a1b~
Comments: Below M989.
Forward Primer: Y21903_F TGAAGTTTTGCTCCTGTTGC
Reverse Primer: Y21903_R AGCTCTGAAAGTTGCCTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies