Top » Catalog » SNPs » FGC66792

$19.00

FGC66792
[FGC66792]

FGC66792
hg38 Position: ChrY:12772502..12772502
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: G
Comments: .
Forward Primer: FGC66792_F TGTCTGCCCTATGACACCAG
Reverse Primer: FGC66792_R AATCTTGGCTCACAGCAACC
Reviews

Customers who bought this product also purchased
FGC66798
FGC66798
FGC66797
FGC66797
FGC66793
FGC66793
FGC66803
FGC66803
FGC66784
FGC66784
FGC66802
FGC66802
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies