Top » Catalog » SNPs » Z17264

$18.00

Z17264
[Z17264]

Z17264
hg38 Position: ChrY:21710001..21710001
Ancestral: A
Derived: G
Reference: Y DNA community
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13 > Z5016 > S26015
Forward Primer: Z17264_F CAGTTTCCCTAGGATCTCCTTTATG
Reverse Primer: Z17264_R GGATAAGCTGAACAGCCACTG
Reviews

Customers who bought this product also purchased
BY4600
BY4600
BY4455
BY4455
SK888
SK888
Y161798
Y161798
Y161799
Y161799
Y97307
Y97307
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies