Top » Catalog » SNPs » M174

$18.00

M174
[M174]

M174
hg38 Position: ChrY:12842354..12842354
Ancestral: T
Derived: C
Reference: Underhill et al. 2001
ISOGG Haplogroup: D
Comments: DffryEx38
Forward Primer: M174_F ACATCTCAGATCGTTGTTTGGT
Reverse Primer: M174_R AAAAAGCCATGCAATTACCTG
Reviews

Customers who bought this product also purchased
Z34364
Z34364
Z34359
Z34359
CTS1828
CTS1828
Y148136
Y148136
M533
M533
Z34227
Z34227
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies