Top » Catalog » SNPs » YFS252509

$18.00

YFS252509
[YFS252509]

YFS252509
HG19 Position: ChrY:10028341..10028341
Ancestral: T
Derived: C
Reference: Ronald Bartlett (2017)
ISOGG Haplogroup: I1
Comments: Below Z63 > S2077
Forward Primer: YFS252509_F TAATTATCATATGATAAATTATCATAATTATCACTG
Reverse Primer: YFS252509_R GCCATTTAAGAAACAGTGATGTTAGC
Reviews

Customers who bought this product also purchased
BY13501
BY13501
Wish a SNP
Wish a SNP
YFS252559
YFS252559
YFS252558
YFS252558
YFS252553
YFS252553
BY13535
BY13535
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies