Top » Catalog » SNPs » YFS252553

$18.00

YFS252553
[YFS252553]

YFS252553
HG19 Position: ChrY:16671630..16671630
Ancestral: C
Derived: T
Reference: Ronald Bartlett (2017)
ISOGG Haplogroup: I1
Comments: Below Z63 > S2077
Forward Primer: YFS252553_F GAGTGAGCCACTGTGTACGG
Reverse Primer: YFS252553_R ATTGTTCCAGTCCCCAAGG
Reviews

Customers who bought this product also purchased
BY13535
BY13535
BY13501
BY13501
Wish a SNP
Wish a SNP
YFS252559
YFS252559
YFS252558
YFS252558
YFS252509
YFS252509
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies