Top » Catalog » SNPs » A18232

$18.00

A18232
[A18232]

A18232
hg38 Position: ChrY:21092459..21092459
Ancestral: G
Derived: A
Reference: Kudryashov V. Nikitin (2017)
ISOGG Haplogroup: N1a
Comments: Below L550 > S9378 > A18225
Forward Primer: A18232_F GCTTGCCTAAGACACGTTCC
Reverse Primer: A18232_R CTTGGTGGGGTCACATTAGG
Reviews

Customers who bought this product also purchased
BY21942
BY21942
DNA Sample Kit
DNA Sample Kit
A18222
A18222
A18228
A18228
A18227
A18227
A18225
A18225
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies