Top » Catalog » SNPs » Y33591

$18.00

Y33591
[Y33591]

Y33591
hg38 Position: ChrY:11942775..11942775
Ancestral: C
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: E1a1
Comments: Below M44 > Y24438
Forward Primer: Y33591_F CTCAGCAGTCATGTGGCTTG
Reverse Primer: Y33591_R GCAAAATTTGCACACAGGC
Reviews

Customers who bought this product also purchased
DYS390
DYS390
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
DYS439
DYS439
DYS448
DYS448
DYS607
DYS607
CDY
CDY
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies