Top » Catalog » SNPs » BY6697

$18.00

BY6697
[BY6697]

BY6697
HG19 Position: ChrY:23265511..23265511
Ancestral: G
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1b1a1b2a4c1a1b~
Comments: Aka Y21870. Below Y16563
Forward Primer: BY6697_F TGGGATCCTTCTTCAAGTGG
Reverse Primer: BY6697_R GGTCCCTATGTTGCCTTGTG
Reviews

Customers who bought this product also purchased
M215
M215
Y16563
Y16563
P177
P177
V22
V22
FGC37180
FGC37180
E Superclade Panel
E Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies