Top » Catalog » SNPs » BY6697

$18.00

BY6697
[BY6697]

BY6697
hg38 Position: ChrY:21103625..21103625
Ancestral: G
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1b1a1b2a4c1a1b~
Comments: Aka Y21870. Below Y16563
Forward Primer: BY6697_F TGGGATCCTTCTTCAAGTGG
Reverse Primer: BY6697_R GGTCCCTATGTTGCCTTGTG
Reviews

Customers who bought this product also purchased
BY6712
BY6712
M78
M78
Y16536
Y16536
BY6740
BY6740
M215
M215
Y16563
Y16563
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies